wdr24

Ensembl ID:
ENSDARG00000025507
ZFIN ID:
ZDB-GENE-040426-2012
Description:
WD repeat-containing protein 24 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVL2]
Human Orthologue:
WDR24
Human Description:
WD repeat domain 24 [Source:HGNC Symbol;Acc:20852]
Mouse Orthologue:
Wdr24
Mouse Description:
WD repeat domain 24 Gene [Source:MGI Symbol;Acc:MGI:2446285]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37947 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008047 Nonsense 259 779 7 14
Genomic Location (Zv9):
Chromosome 24 (position 39152896)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37761985
GRCz11 24 37649882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACCATCGCTTCGGTGGCGCGGGTCAAGTGGCGTCCGGAGCGCCGCTA[T/G]CATCTGGCCACCTGCTCCATGATGGTGGACCACAACATCTACGTGTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link