
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gucy2f
- Ensembl ID:
- ENSDARG00000025504
- ZFIN ID:
- ZDB-GENE-011128-7
- Description:
- retinal guanylyl cyclase 2 [Source:RefSeq peptide;Acc:NP_571939]
- Mouse Orthologue:
- Gucy2d
- Mouse Description:
- guanylate cyclase 2d Gene [Source:MGI Symbol;Acc:MGI:106030]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22668 | Essential Splice Site | Available for shipment | Available now |
sa35912 | Essential Splice Site | Available for shipment | Available now |
sa42568 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22668
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099916 | Essential Splice Site | None | 259 | 16 | 19 |
ENSDART00000126196 | Essential Splice Site | 1019 | 1107 | 15 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 28724744)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29442774 GRCz11 15 29375650 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGC[G/A]TATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35912
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099916 | Essential Splice Site | None | 259 | None | 19 |
ENSDART00000126196 | Essential Splice Site | 1020 | 1107 | None | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 28724745)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29442775 GRCz11 15 29375651 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGGAGACACAGTCAACACCGCCTCTCGTATGGAATCTACAGGGTTGCG[T/G]ATGTTCCATTTAGATTTCTTTTTTACAGATGTGATATGGAAACATTGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42568
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099916 | None | 259 | 18 | 19 | |
ENSDART00000126196 | Nonsense | 1076 | 1107 | 17 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 28726790)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29444820 GRCz11 15 29377696 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGGCTTGTTGGGAAAGCTAATTTTACTAAGCCTTTGCCAAATCCACCA[G/T]AGATCAAACCAGGGTAAGATTTTAATATTATTTTAACATAATTTTTTACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: