
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
GIPR
- Ensembl ID:
- ENSDARG00000025478
- Description:
- gastric inhibitory polypeptide receptor [Source:HGNC Symbol;Acc:4271]
- Human Orthologue:
- GIPR
- Human Description:
- gastric inhibitory polypeptide receptor [Source:HGNC Symbol;Acc:4271]
- Mouse Orthologue:
- Gipr
- Mouse Description:
- gastric inhibitory polypeptide receptor Gene [Source:MGI Symbol;Acc:MGI:1352753]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30995 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22664 | Essential Splice Site | Available for shipment | Available now |
sa22665 | Essential Splice Site | Available for shipment | Available now |
sa39053 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30995
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029459 | Nonsense | 66 | 499 | 3 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 28306182)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29024212 GRCz11 15 28957088 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGACAGATGGAGTTCCCAACACAACAGTGAAAGTGCCCTGCCCCTGGTA[T/A]CTGCCCTGGCATGATCAAGGTATTGCTGCCAACAATAGTGCCAGATGGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22664
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029459 | Essential Splice Site | 113 | 499 | 4 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 28307382)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29025412 GRCz11 15 28958288 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGAGACCACTCACAGTGCAATGCAGATGGCAGACAGCAGATAGCACAGG[T/C]ACAGAGACCCCAAACTCAGCATTAAAAGGTGTCACATGCTGTCACATTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22665
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029459 | Essential Splice Site | 201 | 499 | 7 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 28316140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29034170 GRCz11 15 28967046 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAGCAATGTCCAATAAAATAAACTATTAAACGCACCTTAAATCCTCAC[A/G]GGTGATGTCAGGCTGCCGTGTGGCTCAGGTCCTGATGCAGTACTGTGTCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39053
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029459 | Nonsense | 366 | 499 | 11 | 13 |
- Genomic Location (Zv9):
- Chromosome 15 (position 28319592)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29037622 GRCz11 15 28970498 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGACAGAGGAACAGACTGAAGGAGTACTTCGCAATGTCAACCTGTTCTTT[G/T]AACTCTTCTTCAATTCTTTTCAGGTACAACTTAGTGAATCAAGAGAGACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
- Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)
- Body mass index: Meta-analysis identifies common variants associated with body mass index in east Asians. (View Study)
- Two-hour glucose challenge: Genetic variation in GIPR influences the glucose and insulin responses to an oral glucose challenge. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: