zgc:77174

Ensembl ID:
ENSDARG00000025421
ZFIN ID:
ZDB-GENE-040426-19
Description:
Tudor domain-containing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYG6]
Human Orthologue:
TDRD3
Human Description:
tudor domain containing 3 [Source:HGNC Symbol;Acc:20612]
Mouse Orthologue:
Tdrd3
Mouse Description:
tudor domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444023]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35158 Essential Splice Site Available for shipment Available now
sa41916 Nonsense Mutation detected in F1 DNA During 2018
sa21978 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028955 Essential Splice Site 348 734 9 14
Genomic Location (Zv9):
Chromosome 11 (position 43879189)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42506474
GRCz11 11 42798555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGCCCAGAGCAGCCCCAGTGGAGCAGAGCCGCCCGCCGCCCCGAGG[T/C]AAAAACCTGCAGATGGTTATAAACGAAAAATAACCAGAGAGCAACTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028955 Nonsense 507 734 11 14
Genomic Location (Zv9):
Chromosome 11 (position 43889926)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42517211
GRCz11 11 42809292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCAAGTCCAGAGAGCAGCAGGGTGCGTCTGGAAAGGAGCTTAATAAA[G/T]AGCAGGATGGCACAGGACCTGCTTCATTTAGGAAAAACCAATCAAACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028955 Nonsense 717 734 13 14
Genomic Location (Zv9):
Chromosome 11 (position 43895523)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42522808
GRCz11 11 42814889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTATGAAAATTCTCTTGAGTTTCGAAGAGGAGGAGATGGACAACCT[C/T]GACGCTCTCGACCGACACAACAATATTACCAACCGCCTCGTGCAAGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link