ube2g2

Ensembl ID:
ENSDARG00000025404
ZFIN ID:
ZDB-GENE-050417-288
Description:
ubiquitin-conjugating enzyme E2 G2 [Source:RefSeq peptide;Acc:NP_001017767]
Human Orthologue:
UBE2G2
Human Description:
ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) [Source:HGNC Symbol;Acc:12483]
Mouse Orthologue:
Ube2g2
Mouse Description:
ubiquitin-conjugating enzyme E2G 2 Gene [Source:MGI Symbol;Acc:MGI:1343188]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa653 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa653
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032118 Essential Splice Site 128 165 5 6
Genomic Location (Zv9):
Chromosome 6 (position 9190182)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8370482
GRCz11 6 8606021
KASP Assay ID:
554-0561.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGCAGAGTGTGGAGAAGATCCTGCTGTCTGTGGTCAGCATGCTCGCCG[G/A]TCAGTCACCATTTTTGATCCCGNTTTGCCTAAAAGTGGTTCCTGAGAAATY
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link