
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000025364
- Ensembl ID:
- ENSDARG00000025364
- Human Orthologue:
- ACTN4
- Human Description:
- actinin, alpha 4 [Source:HGNC Symbol;Acc:166]
- Mouse Orthologue:
- Actn4
- Mouse Description:
- actinin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1890773]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39517 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24820 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39517
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032887 | Nonsense | 206 | 426 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA540 (position 8012)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150305.1 8012 GRCz11 15 43485696 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCCATGCTCACACAAAAGGACTATGAAACCGCATCCCTGTCTGAGATT[A/T]AAGCTCTCCTGAAGAAACACGAGGCCTTCGAGAGCGACCTTGCCGCCCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24820
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032887 | Nonsense | 384 | 426 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA540 (position 870)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150305.1 870 GRCz11 15 43492838 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTAAGGATCAGCAGTGTTGATGTAATCTCTCCTGTCTATGCAGGTGCAG[C/T]AACTGGTTCCACAGCGTGATCAGGCACTACAGGAGGAACTCACCCGTCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: