
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tspan9
- Ensembl ID:
- ENSDARG00000025299
- ZFIN ID:
- ZDB-GENE-060503-632
- Description:
- Novel protein similar to vertebrate Tetraspanin family [Source:UniProtKB/TrEMBL;Acc:Q1LXC5]
- Human Orthologue:
- TSPAN9
- Human Description:
- tetraspanin 9 [Source:HGNC Symbol;Acc:21640]
- Mouse Orthologue:
- Tspan9
- Mouse Description:
- tetraspanin 9 Gene [Source:MGI Symbol;Acc:MGI:1924558]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39192 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa23241 | Nonsense | Available for shipment | Available now |
sa6503 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39192
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040500 | Essential Splice Site | 7 | 241 | 2 | 7 |
ENSDART00000146692 | None | 227 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 10508608)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 11091854 GRCz11 18 11060572 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGTTATTGTCCATCTGGTATCTGTGGCACATATTGAATGTAGTTGTACA[G/T]ATGTTCCAGAACGCATCAGTATCTGATAATCTGTTCTTTCTGTCTGCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23241
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040500 | Nonsense | 40 | 241 | 2 | 7 |
ENSDART00000146692 | Nonsense | 26 | 227 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 10508510)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 11091756 GRCz11 18 11060474 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTTGTGTGGCTGTGGGCTGCTGGGAGTTGGAATCTGGCTGTCTGTTTCT[C/T]AAGGCAGCTTCGCCACCTTCTCCCCCTCCTTCCCCTCTCTCTCCGCTGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6503
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040500 | Essential Splice Site | 219 | 241 | 7 | 7 |
ENSDART00000146692 | Essential Splice Site | 205 | 227 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 10464311)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 11047557 GRCz11 18 11016275 - KASP Assay ID:
- 554-4236.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCATGCAGTATATGTCATGTTAACCTTTCTCCTGAATTTTGTCATTTCR[G/T]CTCCTGGGAATGGCCTTTTCCATGACACTGTTCCATCAGATCCACAGAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: