
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
epc1
- Ensembl ID:
- ENSDARG00000025241
- ZFIN ID:
- ZDB-GENE-070629-5
- Human Orthologue:
- EPC1
- Human Description:
- enhancer of polycomb homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19876]
- Mouse Orthologue:
- Epc1
- Mouse Description:
- enhancer of polycomb homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1278322]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38904 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa44775 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38904
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000033072 | Essential Splice Site | 404 | 796 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 12 (position 43382576)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 40963764 GRCz11 12 41458325 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGATGGAGCGTTTGCCTTCAGGCGGAAAGCAGGATGTGTTTATCACGCT[G/A]TAGGTGTCCAGACCTGACCTCATATCTCATACCTTGTTCTTCCTCTGTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44775
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000033072 | Essential Splice Site | 773 | 796 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 12 (position 43373602)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 40972738 GRCz11 12 41467299 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTGAAGCTTGCCGCAAGCAACTGTCAGCTTCCCAAAGCCAACGCTGGG[T/A]AACCTTTATTTATTTATTTTTTATCACATTTTCTCATAGTTAGCACACCG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Sexual dysfunction (female): A genome-wide association study of female sexual dysfunction. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: