zgc:152851

Ensembl ID:
ENSDARG00000025233
ZFIN ID:
ZDB-GENE-060929-112
Description:
lipoyltransferase 1, mitochondrial [Source:RefSeq peptide;Acc:NP_001068570]
Human Orthologue:
LIPT1
Human Description:
lipoyltransferase 1 [Source:HGNC Symbol;Acc:29569]
Mouse Orthologue:
Lipt1
Mouse Description:
lipoyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:3645211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15097 Nonsense Available for shipment Available now
sa10633 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033669 Nonsense 92 372 1 1
Genomic Location (Zv9):
Chromosome 1 (position 46393834)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45231346
GRCz11 1 45923141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCGGAAGACACCAAAACCCCTGGCAGGAGTGCAACCTTCCCGSGACG[C/T]GACGGTTGGGGATCCCGCTGGCGAGGCGGCGCAGTGGAGGCGGGACRGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033669 Nonsense 311 372 1 1
Genomic Location (Zv9):
Chromosome 1 (position 46394492)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45232004
GRCz11 1 45923799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTAAGCTTGATATGGATGTCAGGAATGGTACTGTGGAGCGATGTGCTT[T/A]GGAAATCCCTGCAGACTGGCTTTCWCCAGAGATTGTGAATGAGCTTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link