znf668

Ensembl ID:
ENSDARG00000025226
ZFIN ID:
ZDB-GENE-041001-46
Description:
zinc finger protein 668 [Source:RefSeq peptide;Acc:NP_001012507]
Human Orthologue:
ZNF668
Human Description:
zinc finger protein 668 [Source:HGNC Symbol;Acc:25821]
Mouse Orthologue:
Zfp668
Mouse Description:
zinc finger protein 668 Gene [Source:MGI Symbol;Acc:MGI:2442943]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42052 Nonsense Mutation detected in F1 DNA During 2018
sa16082 Nonsense Available for shipment Available now
sa17530 Nonsense Available for shipment Available now
sa22122 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033878 Nonsense 119 643 2 2
ENSDART00000123417 Nonsense 119 643 3 3
ENSDART00000139347 Nonsense 119 643 3 3
Genomic Location (Zv9):
Chromosome 12 (position 30507036)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28843973
GRCz11 12 28958875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCATTCACCTCAGCGTCCGTTCCAGTGCCTGCAGTGCCATAAGGCTTA[T/G]AAGACTCCAACGGAATTACGCAACCACAGTCGCTCACACACAGGGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033878 Nonsense 325 643 2 2
ENSDART00000123417 Nonsense 325 643 3 3
ENSDART00000139347 Nonsense 325 643 3 3
Genomic Location (Zv9):
Chromosome 12 (position 30507652)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28844589
GRCz11 12 28959491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCACAGTGTGGTAAGATGTTCTCGGATCCCTCTAGTTTCCGCCKAYAC[C/T]AACGGGCACATCAAGGATTCAAGCCATACCCTTGCGACAAGTGCACTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033878 Nonsense 369 643 2 2
ENSDART00000123417 Nonsense 369 643 3 3
ENSDART00000139347 Nonsense 369 643 3 3
Genomic Location (Zv9):
Chromosome 12 (position 30507784)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28844721
GRCz11 12 28959623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWCAACGTGTGCACTCTGGCCAGCGACCCTATAAATGCCAAYGTTGTGAT[A/T]AAGCTTTTGTRGCTTCTTGGGATCTTCGGCGCCACATGCTAGTGCATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033878 Nonsense 556 643 2 2
ENSDART00000123417 Nonsense 556 643 3 3
ENSDART00000139347 Nonsense 556 643 3 3
Genomic Location (Zv9):
Chromosome 12 (position 30508346)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28845283
GRCz11 12 28960185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGGTTTTCTGAATAAAGCTGGTCTTCGTAAACACCAGCGTATCCACT[C/A]AAGTAATCGGCCACATAGTTGCAATGTTTGCGGGAAGGCTTTTCTTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link