six6a

Ensembl ID:
ENSDARG00000025187
ZFIN ID:
ZDB-GENE-040426-1282
Description:
sine oculis-related homeobox 6a [Source:RefSeq peptide;Acc:NP_957399]
Human Orthologue:
SIX6
Human Description:
SIX homeobox 6 [Source:HGNC Symbol;Acc:10892]
Mouse Orthologue:
Six6
Mouse Description:
sine oculis-related homeobox 6 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1341840]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31940 Nonsense Available for shipment Available now
sa18444 Nonsense Available for shipment Available now
sa16265 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030646 Nonsense 48 245 1 2
ENSDART00000111763 Nonsense 48 245 2 3
Genomic Location (Zv9):
Chromosome 13 (position 31827919)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31473867
GRCz11 13 31604317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCTTTCTCTGGTCACTCCCGGTGGCGCCGTCCGCCTGCGATGTGCTC[G/T]GAAAGAACGAGTCTGTCCTGCGCGCGCGCGCGGTCGTGGCCTTTCACGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030646 Nonsense 126 245 1 2
ENSDART00000111763 Nonsense 126 245 2 3
Genomic Location (Zv9):
Chromosome 13 (position 31828154)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31474102
GRCz11 13 31604552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGGACAAGTACCGCGTCCGAAAGAAGTTTCCACTGCCCAGGACGATAT[G/A]GGACGGGGAAYAGAAAACGCACWGCTTTAAGGAAAGAACGCGGCATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030646 Nonsense 130 245 1 2
ENSDART00000111763 Nonsense 130 245 2 3
Genomic Location (Zv9):
Chromosome 13 (position 31828165)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31474113
GRCz11 13 31604563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGCGTCCGAAAGAAGTTTCCACTGCCCAGGACGATATRGGACGGGGAA[C/T]AGAAAACGCACWGCTTTAAGGAAAGAACGCGGCATCTGCTGAGAGAGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Glaucoma (primary open-angle): A genome-wide association study in the Japanese population confirms 9p21 and 14q23 as susceptibility loci for primary open angle glaucoma. (View Study)
  • Glaucoma (primary open-angle): Common variants at 9p21 and 8q22 are associated with increased susceptibility to optic nerve degeneration in glaucoma. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link