Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-157c18.2
- Ensembl ID:
- ENSDARG00000025108
- ZFIN ID:
- ZDB-GENE-060503-115
- Description:
- Novel protein containing a WW domain and PDZ domains (Also known as DHR or GLGF) [Source:UniProtKB/T
- Human Orthologues:
- MAGI2, MAGI3
- Human Descriptions:
- membrane associated guanylate kinase, WW and PDZ domain containing 2 [Source:HGNC Symbol;Acc:18957]
- membrane associated guanylate kinase, WW and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29647]
- Mouse Orthologues:
- Magi2, Magi3
- Mouse Descriptions:
- membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI Symbol;Acc:MGI
- membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI
Alleles
There are 4 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa2451 | Essential Splice Site | F2 line generated | During 2018 |
| sa41190 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa21277 | Essential Splice Site | Available for shipment | Available now |
| sa34384 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2451
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000064394 | Essential Splice Site | 94 | 1076 | 1 | 17 |
| ENSDART00000146563 | Essential Splice Site | 94 | 1039 | 1 | 15 |
The following transcripts of ENSDARG00000025108 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 23679658)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 22805476 GRCz11 8 22826715 - KASP Assay ID:
- 554-3165.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTCTCAACTCATGTCCACATCCCATTCGGATCAAAACCGTCTCTCCAGG[T/G]ACTTTAATCACTGATGAGAGCAAACTGAATATGTGTTTGAAAAAGATACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41190
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000064394 | Nonsense | 127 | 1076 | 2 | 17 |
| ENSDART00000146563 | Nonsense | 127 | 1039 | 2 | 15 |
The following transcripts of ENSDARG00000025108 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 23672815)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 22798633 GRCz11 8 22819872 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGGATCCATGGACAGCCAACTCCAACAAGTCATACGGGAGAACCTCTA[C/A]CTGCGCGCCGTGCCCTGTGAGTGATGCAAACATGTTTAATCCAGTACTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21277
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000064394 | Essential Splice Site | 173 | 1076 | 3 | 17 |
| ENSDART00000146563 | Essential Splice Site | 173 | 1039 | 3 | 15 |
The following transcripts of ENSDARG00000025108 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 23659884)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 22785702 GRCz11 8 22806941 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCTCTGGAAGAGTCTGGAGCCTTGCTGGAAAGTGGGAAGTTCAAAGG[T/C]CAGAATCACTGTCTACTTTAAAACCACTTAATGCGTCTAAACTTGTTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34384
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000064394 | Nonsense | 419 | 1076 | 8 | 17 |
| ENSDART00000146563 | Nonsense | 419 | 1039 | 8 | 15 |
The following transcripts of ENSDARG00000025108 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 23642001)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 22767819 GRCz11 8 22789058 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGTTGTTCTTCGTCGAGGTTACCCCATGCTCTACAACCCTGATGGCTG[C/A]CCCAAAACCAGTCTCGCCTCCCCTTCTGACACACCCAACACCAACCCTGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Acute lymphoblastic leukemia (childhood): Genome-wide association study identifies germline polymorphisms associated with relapse of childhood acute lymphoblastic leukemia. (View Study)
- Hippocampal atrophy: Hippocampal atrophy as a quantitative trait in a genome-wide association study identifying novel susceptibility genes for Alzheimer's disease. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Response to antidepressant treatment: Pharmacogenomic study of side-effects for antidepressant treatment options in STAR*D. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
