A8KB88_DANRE

Ensembl ID:
ENSDARG00000025024
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8KB88]
Human Orthologue:
PNOC
Human Description:
prepronociceptin [Source:HGNC Symbol;Acc:9163]
Mouse Orthologue:
Pnoc
Mouse Description:
prepronociceptin Gene [Source:MGI Symbol;Acc:MGI:105308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39156 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030919 Nonsense 77 276 2 3
Genomic Location (Zv9):
Chromosome 17 (position 15957644)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16108472
GRCz11 17 16116405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGCCAGAAGGATTGCCTCTTCTGCAGCCAGAAACTGCCTAATGAATA[T/A]GCCTTCAACAATCTGGTAATTCCCTACATTTCACAAACAACATCTCTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link