synj1

Ensembl ID:
ENSDARG00000025011
ZFIN ID:
ZDB-GENE-030131-9180
Description:
synaptojanin-1 [Source:RefSeq peptide;Acc:NP_001007031]
Human Orthologue:
SYNJ1
Human Description:
synaptojanin 1 [Source:HGNC Symbol;Acc:11503]
Mouse Orthologue:
Synj1
Mouse Description:
synaptojanin 1 Gene [Source:MGI Symbol;Acc:MGI:1354961]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21748 Nonsense Available for shipment Available now
sa8515 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12222 Nonsense Available for shipment Available now
sa27618 Nonsense Mutation detected in F1 DNA During 2018
sa21749 Nonsense Available for shipment Available now
sa34917 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41672 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa18986 Nonsense Mutation detected in F1 DNA During 2018
sa9358 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444 Nonsense 18 1308 2 30
ENSDART00000042829 Nonsense 18 1558 1 31
ENSDART00000134276 Nonsense 18 1554 2 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27151713)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26555570
GRCz11 10 26517283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCAGTAAAGGTTATCGTATTTATCACAAGCTGGATCCACCTCCATA[C/A]AGTGTGATTGTGGAGACCAGAAATCGAGAAGAATGTCTGATGTTCGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444 Essential Splice Site 453 1308 11 30
ENSDART00000042829 Essential Splice Site 454 1558 10 31
ENSDART00000134276 Essential Splice Site 453 1554 11 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27168783)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26572640
GRCz11 10 26534353
KASP Assay ID:
2260-3313.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGCAAGATCTACGCAGGCACTGGTGCTTTAGATGGCAAGGCTAAGG[T/A]ACGTGYTGTCCTGTGAATCWCAAGTAAAACAATACGCTGAATTCTCTCTM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444 Nonsense 511 1308 13 30
ENSDART00000042829 Nonsense 515 1558 12 31
ENSDART00000134276 Nonsense 508 1554 13 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27172808)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26576665
GRCz11 10 26538378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTCTCTCCCTTTCTTTTCTCTTCAATGCTTGCAACRTTAGTCTCT[G/T]AGCCAATTTTACAGTCAGGTATAGTATACACAAACCGACCATAAATCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444 Nonsense 739 1308 18 30
ENSDART00000042829 Nonsense 743 1558 17 31
ENSDART00000134276 Nonsense 736 1554 18 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27177651)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26581508
GRCz11 10 26543221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCTGTACTCTCATGATTATGTATTCTGGTGTGGAGACTTCAACTAC[C/T]GAATCAATATTCCCAATGAAGAGGTGAAGGAGCTGATCAGACAGCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444 Nonsense 947 1308 22 30
ENSDART00000042829 Nonsense 952 1558 21 31
ENSDART00000134276 Nonsense 944 1554 22 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27185402)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26589259
GRCz11 10 26550972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTCCTGCTGAACAGGTTTGTTGAAGAGAAAATGTGGGTGACATTTT[T/A]GGAGGGATACTCAGCTCTGGCCGCTCTGTCTTTGAGTGGGTCTACTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444 Essential Splice Site 1078 1308 24 30
ENSDART00000042829 Essential Splice Site 1083 1558 23 31
ENSDART00000134276 Essential Splice Site 1075 1554 24 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27185963)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26589820
GRCz11 10 26551533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCATCCGACCCAGCAGAGCGCCACCACGCACAGCCGGACCACCACAGG[G/T]TAGTGTAGTATTTGTATTTGACTCAACATGGGTGAACACTTATGTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444 Essential Splice Site 1122 1308 25 30
ENSDART00000042829 Missense 1130 1558 24 31
ENSDART00000134276 Essential Splice Site 1119 1554 25 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27187496)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26591353
GRCz11 10 26553066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCCGCCAGCCCGACCTGCACCTCCACAGCGCCCACCACCACCCTCAG[G/A]TACAGGCACGATGTTTGGTCTTAAGAGAAGCGTTAAGATTCAGTCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444   None 1308 30 30
ENSDART00000042829 Nonsense 1461 1558 31 31
ENSDART00000134276 Nonsense 1457 1554 29 29
ENSDART00000039444   None 1308 30 30
ENSDART00000042829 Nonsense 1461 1558 31 31
ENSDART00000134276 Nonsense 1457 1554 29 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27200497)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26604354
GRCz11 10 26566067
KASP Assay ID:
2260-3317.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGCTGTAGGCCACAGTTCCACCCTTCCTCCAACGTTCTCCCGACAA[C/T]AGTCCTTAGTTACTGCTACAGCTCCAGCCCCCAACAAACAAACGCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039444   None 1308 30 30
ENSDART00000042829 Nonsense 1461 1558 31 31
ENSDART00000134276 Nonsense 1457 1554 29 29
ENSDART00000039444   None 1308 30 30
ENSDART00000042829 Nonsense 1461 1558 31 31
ENSDART00000134276 Nonsense 1457 1554 29 29

The following transcripts of ENSDARG00000025011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 27200497)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26604354
GRCz11 10 26566067
KASP Assay ID:
2260-3317.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGCTGTAGGCCACAGTTCCACCCTTCCTCCAACSTTCTCCCGACAA[C/T]AGTCCTTAGTTACTGCTACAGCTCCAGCCCCCAACAAACAAACGCAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link