
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fancg
- Ensembl ID:
- ENSDARG00000024967
- ZFIN ID:
- ZDB-GENE-050417-103
- Description:
- fanconi anemia complementation group G protein [Source:RefSeq peptide;Acc:NP_991202]
- Human Orthologue:
- FANCG
- Human Description:
- Fanconi anemia, complementation group G [Source:HGNC Symbol;Acc:3588]
- Mouse Orthologue:
- Fancg
- Mouse Description:
- Fanconi anemia, complementation group G Gene [Source:MGI Symbol;Acc:MGI:1926471]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20504 | Essential Splice Site | Available for shipment | Available now |
sa15941 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20504
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039369 | Essential Splice Site | 93 | 617 | 3 | 14 |
The following transcripts of ENSDARG00000024967 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 43115699)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 40896964 GRCz11 5 41497117 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTAACCCAAGCGAGATGGAGGAGAGTCTGACCCGCAGTTTATTCAGAG[G/A]TAAGTACAGCAGCGTCGTTTATTGCTCATTTACATGCCGTATTGTGTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15941
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039369 | Nonsense | 273 | 617 | 7 | 14 |
The following transcripts of ENSDARG00000024967 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 43119093)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 40900358 GRCz11 5 41500511 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTATAGGAAGGCAKTGGAGGTAGATTTTTCTTGTCTTGGYGCACTTTA[T/A]CAAAGTGCTCTGGTGTTCAGACAGCTTGGCAATCCAAAGGCWGAAATGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: