tmed4

Ensembl ID:
ENSDARG00000024954
ZFIN ID:
ZDB-GENE-040625-140
Description:
transmembrane emp24 domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001002134]
Human Orthologue:
TMED4
Human Description:
transmembrane emp24 protein transport domain containing 4 [Source:HGNC Symbol;Acc:22301]
Mouse Orthologue:
Tmed4
Mouse Description:
transmembrane emp24 protein transport domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1915070]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44027 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039433 Essential Splice Site 171 220 4 5
ENSDART00000144609 Essential Splice Site 176 225 4 5

The following transcripts of ENSDARG00000024954 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 34293309)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34055256
GRCz11 23 33981787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCTGGACCAGGTGGAGCAGATCCAGAAAGAGCAGAACTACCAACGG[G/T]TGAGTCTTAAAGGGACAGTTCACTCAAAACTGACAATAATGTCATCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link