stil

Ensembl ID:
ENSDARG00000024904
ZFIN ID:
ZDB-GENE-020419-39
Description:
SCL-interrupting locus protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8JGS1]
Human Orthologue:
STIL
Human Description:
SCL/TAL1 interrupting locus [Source:HGNC Symbol;Acc:10879]
Mouse Orthologue:
Stil
Mouse Description:
Scl/Tal1 interrupting locus Gene [Source:MGI Symbol;Acc:MGI:107477]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29746 Nonsense Mutation detected in F1 DNA During 2018
sa14967 Nonsense Available for shipment Available now
sa24122 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033617 Nonsense 489 1263 11 16
Genomic Location (Zv9):
Chromosome 22 (position 16112984)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15940554
GRCz11 22 15966824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACAGTAGTCCTGCCCTCCAGGGTCTCTCTGTTCTGAGACCTCTAGTA[C/T]AGGGAAGCGTTACTAAACCCCCTCCAATCCGAAGACCACTAACTCCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033617 Nonsense 519 1263 11 16
Genomic Location (Zv9):
Chromosome 22 (position 16113074)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15940644
GRCz11 22 15966914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTCCCATTCTTTCTCAGCCGAAGAACAAGTTACATCCTAAYCCATCA[C/T]AACAAACACCACAACACAGTGTGAGTCGAAAATCMYWGCCCTCAATGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033617 Nonsense 567 1263 11 16
Genomic Location (Zv9):
Chromosome 22 (position 16113218)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15940788
GRCz11 22 15967058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCTCTTCCTCAACAAAAAACGCTTCACCCAATGGCTCTTTTCATCAA[C/T]AAAGGCAGCGTTTATCTCAGGGTTTCCCAAACAAACCCCAGCTGATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link