
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ctnna2
- Ensembl ID:
- ENSDARG00000024785
- ZFIN ID:
- ZDB-GENE-060815-3
- Description:
- Catenin alpha-2 [Source:UniProtKB/Swiss-Prot;Acc:B7ZC77]
- Human Orthologue:
- CTNNA2
- Human Description:
- catenin (cadherin-associated protein), alpha 2 [Source:HGNC Symbol;Acc:2510]
- Mouse Orthologue:
- Ctnna2
- Mouse Description:
- catenin (cadherin associated protein), alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88275]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16103 | Nonsense | Available for shipment | Available now |
sa32731 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa2006 | Nonsense | F2 line generated | During 2018 |
sa32732 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16103
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017139 | None | 352 | None | 7 | |
ENSDART00000101306 | Nonsense | 396 | 865 | 9 | 17 |
ENSDART00000101311 | None | 293 | None | 7 | |
ENSDART00000110860 | None | 373 | None | 7 | |
ENSDART00000138740 | None | 430 | None | 9 | |
ENSDART00000143871 | None | 271 | None | 5 |
The following transcripts of ENSDARG00000024785 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 43362451)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 42278767 GRCz11 1 42979931 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTCACCAACATCATWCTTTCTGTGTTTTTCAGGTGGCCAACCTCGCCTG[T/A]TCCATCTCCAACAATGAGGAGGGGGTGAAGYTAGTGCGCATGGCTGCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32731
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017139 | None | 352 | None | 7 | |
ENSDART00000101306 | Nonsense | 414 | 865 | 9 | 17 |
ENSDART00000101311 | None | 293 | None | 7 | |
ENSDART00000110860 | None | 373 | None | 7 | |
ENSDART00000138740 | None | 430 | None | 9 | |
ENSDART00000143871 | None | 271 | None | 5 |
The following transcripts of ENSDARG00000024785 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 43362503)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 42278819 GRCz11 1 42979983 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCATCTCCAACAATGAGGAGGGGGTGAAGTTAGTGCGCATGGCTGCTACA[C/T]AGATCGATAGCCTGTGTCCTCAGGTAAAAAGGCCAGAACCTTCTGCTATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2006
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017139 | None | 352 | None | 7 | |
ENSDART00000101306 | Nonsense | 646 | 865 | 14 | 17 |
ENSDART00000101311 | None | 293 | None | 7 | |
ENSDART00000110860 | None | 373 | None | 7 | |
ENSDART00000138740 | None | 430 | None | 9 | |
ENSDART00000143871 | None | 271 | None | 5 | |
ENSDART00000017139 | None | 352 | None | 7 | |
ENSDART00000101306 | Nonsense | 646 | 865 | 14 | 17 |
ENSDART00000101311 | None | 293 | None | 7 | |
ENSDART00000110860 | None | 373 | None | 7 | |
ENSDART00000138740 | None | 430 | None | 9 | |
ENSDART00000143871 | None | 271 | None | 5 |
The following transcripts of ENSDARG00000024785 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 43405283)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 42321599 GRCz11 1 43022763 - KASP Assay ID:
- 554-3244.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGCCATCATGGCTCAGCTGCCTCAGGAAGAAAAGGCCAAGATTGCTGAA[C/T]AGGTCGAGAGCTTCAGGCAGGAAAAGAGCAAGCTGGACGCTGAAGTCGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32732
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017139 | None | 352 | None | 7 | |
ENSDART00000101306 | Nonsense | 677 | 865 | 14 | 17 |
ENSDART00000101311 | None | 293 | None | 7 | |
ENSDART00000110860 | None | 373 | None | 7 | |
ENSDART00000138740 | None | 430 | None | 9 | |
ENSDART00000143871 | None | 271 | None | 5 |
The following transcripts of ENSDARG00000024785 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 43405376)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 42321692 GRCz11 1 43022856 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTCGCTAAGTGGGATGACAATGGAAATGACATCATCGTGTTGGCTAAG[C/T]AGATGTGTATGATCATGATGGAGATGACTGACTTCACCAGGTACATCCGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Alzheimer's disease (cognitive decline): Genome-wide association study of the rate of cognitive decline in Alzheimer's disease. (View Study)
- Bipolar disorder: Genome-wide association and meta-analysis of bipolar disorder in individuals of European ancestry. (View Study)
- Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: