pgm3

Ensembl ID:
ENSDARG00000024654
ZFIN ID:
ZDB-GENE-041024-13
Description:
phosphoacetylglucosamine mutase [Source:RefSeq peptide;Acc:NP_001007054]
Human Orthologue:
PGM3
Human Description:
phosphoglucomutase 3 [Source:HGNC Symbol;Acc:8907]
Mouse Orthologue:
Pgm3
Mouse Description:
phosphoglucomutase 3 Gene [Source:MGI Symbol;Acc:MGI:97566]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13183 Nonsense Available for shipment Available now
sa20197 Nonsense Available for shipment Available now
sa30846 Nonsense Mutation detected in F1 DNA During 2018
sa26214 Nonsense Mutation detected in F1 DNA During 2018
sa40219 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039987 Nonsense 165 545 5 13
Genomic Location (Zv9):
Chromosome 4 (position 5663983)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5782164
GRCz11 4 5790734
KASP Assay ID:
2259-4458.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NTTCTCTTGAATGCAGATTATGGWCTGGTCAGCACTCCGCAGCTCCATTA[T/A]ATGGTGTGCTGCTGCAACACAAAGGGCCGCTATGGCAGTGCCACCCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039987 Nonsense 190 545 5 13
Genomic Location (Zv9):
Chromosome 4 (position 5663910)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5782091
GRCz11 4 5790661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCCGCTATGGCAGTGCCACCCTTGAGGGTTATTACCAAAAACTCTCC[C/T]AGGCTTTCCTTCAACTCACCCACAATGTAAGCACGACTAACAAACATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039987 Nonsense 258 545 6 13
Genomic Location (Zv9):
Chromosome 4 (position 5663623)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5781804
GRCz11 4 5790374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCAGTGGAAAACTCAACCACTTGTGTGGAGCAGATTATGTCAAAGTC[C/T]AGCAGAAAGCTCCCCAAGGTTTGTCTGAAATTCCTGAAGGGGAAATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039987 Nonsense 274 545 7 13
Genomic Location (Zv9):
Chromosome 4 (position 5662266)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5780447
GRCz11 4 5789017
KASP Assay ID:
2259-4456.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATATTTTTTCCTGCAGGTGTGAGTATGGGAGTAGGTGAACGCTGCTG[T/A]TCATTTGATGGTGATGCCGATCGCATTGTTTACTATTACACCGACTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039987 Essential Splice Site 417 545 10 13
Genomic Location (Zv9):
Chromosome 4 (position 5660117)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5778298
GRCz11 4 5786868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACATGCTGCAAAACTCCTGGAGAACACCGTCAATCTGATCAACCAGG[T/C]ATATATACAAACACAAACGCTGTTACAGAAGCTCTTAATTACTGACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link