zgc:158838

Ensembl ID:
ENSDARG00000024642
ZFIN ID:
ZDB-GENE-041111-123
Description:
hypothetical protein LOC492549 [Source:RefSeq peptide;Acc:NP_001082822]
Human Orthologue:
PIP5K1A
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha [Source:HGNC Symbol;Acc:8994]
Mouse Orthologue:
Pip5k1a
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha Gene [Source:MGI Symbol;Acc:MGI:107929]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22761 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020859 Nonsense 159 584 6 16
Genomic Location (Zv9):
Chromosome 16 (position 11342614)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9857664
GRCz11 16 9748566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCCTTGATCGAACTGTCCAATCCTGGAGCAAGCGGATCCATCTTTTA[C/A]GTGACCAGCGATGATGAGTTTATTATTAAAACAGTCATGCACAAAGAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link