zgc:162964

Ensembl ID:
ENSDARG00000024602
ZFIN ID:
ZDB-GENE-030131-9798
Description:
Golgi resident protein GCP60 [Source:RefSeq peptide;Acc:NP_001082856]
Human Orthologue:
ACBD3
Human Description:
acyl-CoA binding domain containing 3 [Source:HGNC Symbol;Acc:15453]
Mouse Orthologue:
Acbd3
Mouse Description:
acyl-Coenzyme A binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2181074]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23126 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032827 Essential Splice Site 425 495 7 8
Genomic Location (Zv9):
Chromosome 17 (position 33592028)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33433759
GRCz11 17 33386270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGACAAGCAGCAATAATGGAGGAGAATCTACTACTGAAACCAAAGAAG[G/T]TAAGGCAGTGGATTTTTTTGACAAACAGAAACATATACTGAGTAAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link