wu:fk11d03

Ensembl ID:
ENSDARG00000024598
ZFIN ID:
ZDB-GENE-030131-9225
Description:
wu:fk11d03 [Source:RefSeq peptide;Acc:NP_001124256]
Human Orthologue:
HOMEZ
Human Description:
homeobox and leucine zipper encoding [Source:HGNC Symbol;Acc:20164]
Mouse Orthologue:
Homez
Mouse Description:
homeodomain leucine zipper-encoding gene Gene [Source:MGI Symbol;Acc:MGI:2678023]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15315 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033755 Nonsense 614 718 2 2
Genomic Location (Zv9):
Chromosome 7 (position 25179891)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23741643
GRCz11 7 24012800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTGCGGCAGAGTTTCCTTTGCTGCCAGTGGCCCACAAGTGAYGATTA[C/A]GAGATCCTGCAGAAGAAGACAGGCCTGACGAGGACAGAGATCATCCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link