si:dkey-236e20.9

Ensembl ID:
ENSDARG00000024588
ZFIN ID:
ZDB-GENE-060503-64
Description:
Novel protein similar to vertebrate glypican 5 (GPC5) [Source:UniProtKB/TrEMBL;Acc:Q1L879]
Human Orthologue:
GPC5
Human Description:
glypican 5 [Source:HGNC Symbol;Acc:4453]
Mouse Orthologue:
Gpc5
Mouse Description:
glypican 5 Gene [Source:MGI Symbol;Acc:MGI:1194894]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24115 Nonsense Available for shipment Available now
sa14157 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010846 Nonsense 71 610 2 9
ENSDART00000139800 Nonsense 69 534 2 7
Genomic Location (Zv9):
Chromosome 22 (position 15588334)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15416343
GRCz11 22 15442726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACAGATGCAGAACTTCTCATCTGTAAACACCAGGGTCCCACATGCTG[T/A]ACCCGCAAGATGGAGGAGAGCTACTACTCAGCTGCTCAAAGAGACACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010846 Essential Splice Site 552 610 9 9
ENSDART00000139800   None 534 None 7
Genomic Location (Zv9):
Chromosome 22 (position 15646845)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15474854
GRCz11 22 15501237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTTATCTGTATCTAATCCTCACCCCGTTTTTTTCTTCTTCTCCCAAC[A/T]GTGCACTTAAYAAAAGAAAACATAAGCAGTGTTCAAATTCCATCCCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link