si:dkeyp-8f4.3

Ensembl ID:
ENSDARG00000024575
ZFIN ID:
ZDB-GENE-041001-188
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHQ6]
Human Orthologues:
KIF26A, KIF26B
Human Descriptions:
kinesin family member 26A [Source:HGNC Symbol;Acc:20226]
kinesin family member 26B [Source:HGNC Symbol;Acc:25484]
Mouse Orthologues:
Kif26a, Kif26b
Mouse Descriptions:
kinesin family member 26A Gene [Source:MGI Symbol;Acc:MGI:2447072]
kinesin family member 26B Gene [Source:MGI Symbol;Acc:MGI:2447076]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9753 Nonsense Available for shipment Available now
sa37105 Nonsense Mutation detected in F1 DNA During 2018
sa37104 Splice Site, Nonsense Available for shipment Available now
sa6641 Nonsense Mutation detected in F1 DNA During 2018
sa23759 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037195 Nonsense 54 1464 2 13
ENSDART00000131919 Nonsense 15 1456 1 11
Genomic Location (Zv9):
Chromosome 20 (position 35064608)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35137121
GRCz11 20 35040000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTCACAGGGCTGCACAAAAGTTGAATGGGATGGTCAGGAGAGGAAGGT[C/A]GTTCTCAGAAAGCGGCGCTTCTCCACATCTGACAAACTTCAGTGGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037195   None 1464 None 13
ENSDART00000131919 Nonsense 517 1456 8 11
Genomic Location (Zv9):
Chromosome 20 (position 35044332)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35116845
GRCz11 20 35019724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCCACCAATTGGCAATCGCATGAAGCAGATATCAAAAGAAAAGGCC[A/T]AAGAAGAGCCAACACCAACAATATTGCAAAATAAATCAGATTTTGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037195 Splice Site None 1464 None 13
ENSDART00000131919 Nonsense 526 1456 8 11
Genomic Location (Zv9):
Chromosome 20 (position 35044305)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35116818
GRCz11 20 35019697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGATATCAAAAGAAAAGGCCAAAGAAGAGCCAACACCAACAATATTG[C/T]AAAATAAATCAGATTTTGAGTGTCTAAAGTGTAACACATTTGCAGAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037195 Nonsense 672 1464 10 13
ENSDART00000131919 Nonsense 662 1456 8 11
Genomic Location (Zv9):
Chromosome 20 (position 35043896)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35116409
GRCz11 20 35019288
KASP Assay ID:
554-4599.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTATGCTTTACAATAAAAAAATGGATACRACGCCCACTTCACTACCKT[T/A]GAAATTTGAAGACCAAGATAAAACAAGAGTATCAGACGATTCCACAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037195 Nonsense 1430 1464 13 13
ENSDART00000131919 Nonsense 1405 1456 11 11
Genomic Location (Zv9):
Chromosome 20 (position 35038911)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35111424
GRCz11 20 35014303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCAGTTGACTTATGGCAAACCTTTGAGGTAGACTCCCTGGAGCATT[T/A]GGAGGCCTTGGAGGTGGTCACGGAGCGACTAGAGCGTCATGTTAACCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link