
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cryba4
- Ensembl ID:
- ENSDARG00000024548
- ZFIN ID:
- ZDB-GENE-050522-143
- Description:
- beta-crystallin A4 [Source:RefSeq peptide;Acc:NP_001018135]
- Human Orthologue:
- CRYBA4
- Human Description:
- crystallin, beta A4 [Source:HGNC Symbol;Acc:2396]
- Mouse Orthologue:
- Cryba4
- Mouse Description:
- crystallin, beta A4 Gene [Source:MGI Symbol;Acc:MGI:102716]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38813 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18530 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa38813
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046172 | Essential Splice Site | 30 | 164 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 10 (position 45549865)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 44200266 GRCz11 10 44047063 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTGACTTTGCGCTTGAAATCTTTAAAGGTGCCCAACCTCTGTCTTCCA[G/T]ATCATCGTGTATGATGAGGAGTGCTTCCAGGGCCGTCATCATGAGTTCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18530
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046172 | Nonsense | 105 | 164 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 10 (position 45552140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 44202514 GRCz11 10 44049311 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGAATATCCTCAGTGCGACTCCTTTGGAGGAAGCAATGCTTACCACATC[G/T]AGAGAATGACCTCCTTTAGACCAATCTCCTGCGCCGTAAGTYCAGCTCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: