zgc:100919

Ensembl ID:
ENSDARG00000024540
ZFIN ID:
ZDB-GENE-040718-248
Description:
vertebrate transmembrane 4 superfamily-like [Source:RefSeq peptide;Acc:NP_001002748]
Human Orthologue:
TSPAN3
Human Description:
tetraspanin 3 [Source:HGNC Symbol;Acc:17752]
Mouse Orthologue:
Tspan3
Mouse Description:
tetraspanin 3 Gene [Source:MGI Symbol;Acc:MGI:1928098]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21320 Nonsense Available for shipment Available now
sa7616 Missense Mutation detected in F1 DNA During 2018
sa41232 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032498 Nonsense 150 243 5 7
Genomic Location (Zv9):
Chromosome 8 (position 30580061)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29722787
GRCz11 8 29732019
KASP Assay ID:
2260-0751.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACTGTCCACTTGTACATTTCCAGCTGGAGTGCTGTGGTGTGAAAAAC[C/T]AGACCGACTGGACTTTAACATCGTGGTTTGCCCAACATAACAACACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032498 Missense 170 243 5 7
Genomic Location (Zv9):
Chromosome 8 (position 30580121)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29722847
GRCz11 8 29732079
KASP Assay ID:
554-4165.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACTTTAACATCGTGGTTTGCCCAACATAACAACACTGTSCCTCAATCC[T/A]GCTGTAAAGCAAACAKGACGCAGTGCACTGGTCAGCTCTCCCAGCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032498 Nonsense 193 243 6 7
Genomic Location (Zv9):
Chromosome 8 (position 30582235)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29724961
GRCz11 8 29734193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGGAAAAAACAAAATAAAACAAAGACATGTTGTTTCCCCAGGGGTG[T/A]GAAGCTAAACTGGAGCAGGTGCTTCAAGATGTGCTCAGCTATGCAATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link