
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
emilin1a
- Ensembl ID:
- ENSDARG00000024537
- ZFIN ID:
- ZDB-GENE-041001-191
- Description:
- EMILIN-1 [Source:RefSeq peptide;Acc:NP_001025378]
- Human Orthologue:
- EMILIN1
- Human Description:
- elastin microfibril interfacer 1 [Source:HGNC Symbol;Acc:19880]
- Mouse Orthologue:
- Emilin1
- Mouse Description:
- elastin microfibril interfacer 1 Gene [Source:MGI Symbol;Acc:MGI:1926189]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1155 | Nonsense | Available for shipment | Available now |
sa37101 | Splice Site, Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37102 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa1155
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035612 | Nonsense | 375 | 1008 | 4 | 7 |
ENSDART00000128895 | Nonsense | 375 | 1014 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 34884722)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34957235 GRCz11 20 34860114 - KASP Assay ID:
- 554-1066.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGAATAACCGCCTTCGAGACCTGGAGCGGAGATTGAATGGGACTGTGAGA[A/T]AAACTGAGCAAAAATGCTCCCATACAGAGACAAGTATGAAGGAGTTTGTC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa37101
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035612 | Splice Site, Nonsense | 815 | 1008 | 4 | 7 |
ENSDART00000128895 | Splice Site, Nonsense | 815 | 1014 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 34886042)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34958555 GRCz11 20 34861434 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACGGAATGTTCTCAAGGAGTTCCAGATCTTCACTGAACAGGACTTTACT[G/T]GTACGTTCTTAGAATTTATACAGTATACAACATATAGAAATTTGCTACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37102
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035612 | Essential Splice Site | 853 | 1008 | 5 | 7 |
ENSDART00000128895 | Essential Splice Site | 853 | 1014 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 34887636)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34960149 GRCz11 20 34863028 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTAGGAAAGGAAGGCCCACAAGGGAGAGTGGGGCCGGTAGGACCCCCAG[G/T]TAATTAAATGACAACAAATAAATAAATACTACAAAGTTGTAACAACACTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: