zgc:163021

Ensembl ID:
ENSDARG00000024522
ZFIN ID:
ZDB-GENE-070410-126
Description:
hypothetical protein LOC795573 [Source:RefSeq peptide;Acc:NP_001082976]
Human Orthologue:
PRF1
Human Description:
perforin 1 (pore forming protein) [Source:HGNC Symbol;Acc:9360]
Mouse Orthologue:
Prf1
Mouse Description:
perforin 1 (pore forming protein) Gene [Source:MGI Symbol;Acc:MGI:97551]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30641 Nonsense Mutation detected in F1 DNA During 2018
sa45327 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032407 Nonsense 203 516 3 3
ENSDART00000143623 Nonsense 203 225 2 2
Genomic Location (Zv9):
Chromosome 8 (position 30521025)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29663751
GRCz11 8 29672983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTGAATTCTCAAAACATCTCCAAACACTTCCAACACAGTATGATGAC[C/T]AATCTAAACACCTGTACCAGAAAATGATCGAAACCTACGGCACTCACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032407 Nonsense 416 516 3 3
ENSDART00000143623   None 225 None 2
Genomic Location (Zv9):
Chromosome 8 (position 30520384)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29663110
GRCz11 8 29672342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGAGCCACAGGCATGAATGAAGATTATTTTTCATCTTCTGATGGTTA[T/A]GTGAAAGCTTGGTACAATGGTATATACAAGGAGACTGAGGTAATTCTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link