
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bxdc2
- Ensembl ID:
- ENSDARG00000024511
- ZFIN ID:
- ZDB-GENE-060518-1
- Description:
- brix domain containing 2 [Source:RefSeq peptide;Acc:NP_001166027]
- Human Orthologue:
- BRIX1
- Human Description:
- BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24170]
- Mouse Orthologue:
- Brix1
- Mouse Description:
- BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915082]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa3128 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa3128
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000033069 | Nonsense | 235 | 383 | 8 | 10 |
ENSDART00000033069 | Nonsense | 235 | 383 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 21 (position 248654)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 205669 GRCz11 21 227121 - KASP Assay ID:
- 554-3273.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CWGCTCGTGTCCTGCAGGTCTTCTCCACCCCGCTGCACCACCCTAAGAGT[C/T]AGCCGTTCGTGGATCATGTCATYAGCTTCAGCATTGCAGACCACAGGATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: