Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
twistnb
- Ensembl ID:
- ENSDARG00000024416
- ZFIN ID:
- ZDB-GENE-041007-3
- Description:
- DNA-directed RNA polymerase I subunit RPA43 [Source:UniProtKB/Swiss-Prot;Acc:Q6PHG8]
- Human Orthologue:
- TWISTNB
- Human Description:
- TWIST neighbor [Source:HGNC Symbol;Acc:18027]
- Mouse Orthologue:
- Twistnb
- Mouse Description:
- TWIST neighbor Gene [Source:MGI Symbol;Acc:MGI:106292]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa23410 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23410
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000038422 | Nonsense | 217 | 387 | 4 | 5 |
| ENSDART00000127578 | Nonsense | 220 | 390 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 19 (position 2308385)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 2215944 GRCz11 19 2397848 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCATTTGTCGTCGGCTTTCAGAGTGCAGGAGCTCGTGGCCCAATTTGAA[C/T]AAAAACAAGTGACTGCAGAATCAAGCACAGAAGCAGACGCCACAGAAGAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
