arhgap1

Ensembl ID:
ENSDARG00000024324
ZFIN ID:
ZDB-GENE-050417-305
Description:
rho GTPase-activating protein 1 [Source:RefSeq peptide;Acc:NP_001017781]
Human Orthologue:
ARHGAP1
Human Description:
Rho GTPase activating protein 1 [Source:HGNC Symbol;Acc:673]
Mouse Orthologue:
Arhgap1
Mouse Description:
Rho GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:2445003]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38631 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036461 Nonsense 295 434 10 13

The following transcripts of ENSDARG00000024324 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 40171424)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38508064
GRCz11 7 38779322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGGAATATTCCGGCGTTCTGCTAATGTTTCTTTGGTGAAGGATGTT[A/T]AGGCAAAATATAACTCAGGTAAAATCATGAAATGCCCTGTGTAGTTTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link