zgc:65870

Ensembl ID:
ENSDARG00000024276
ZFIN ID:
ZDB-GENE-040426-2122
Description:
poly(rC)-binding protein 4 [Source:RefSeq peptide;Acc:NP_998282]
Human Orthologue:
PCBP4
Human Description:
poly(rC) binding protein 4 [Source:HGNC Symbol;Acc:8652]
Mouse Orthologue:
Pcbp4
Mouse Description:
poly(rC) binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1890471]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39380 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104693 Essential Splice Site 267 442 12 14
ENSDART00000137945 Essential Splice Site 289 464 11 13
Genomic Location (Zv9):
Chromosome 22 (position 35121600)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32361297
GRCz11 22 32315921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGTCCAGCTCCCAGACAGCATCACAAGAACTTCTCATTCCAAATGAC[G/A]TAAGTGCTAAAACTTTTCTTTGCAAGTATCCTATTACTCATGATCCTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link