zgc:112080

Ensembl ID:
ENSDARG00000024229
ZFIN ID:
ZDB-GENE-050417-285
Description:
ubiquitin-like protein 7 [Source:RefSeq peptide;Acc:NP_001017765]
Human Orthologue:
UBL7
Human Description:
ubiquitin-like 7 (bone marrow stromal cell-derived) [Source:HGNC Symbol;Acc:28221]
Mouse Orthologue:
Ubl7
Mouse Description:
ubiquitin-like 7 (bone marrow stromal cell-derived) Gene [Source:MGI Symbol;Acc:MGI:1916709]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44338 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041740 Nonsense 74 379 2 10
Genomic Location (Zv9):
Chromosome 25 (position 32736310)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31347354
GRCz11 25 31758315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATCCATTACAGAGTTAGTGTACTGTGGCAGAAAGTTGAAGGATGACT[T/A]GACTCTGGAATCCTACGGGATTCAGTCGGGATCCACTGTGCACATCCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link