zgc:55582

Ensembl ID:
ENSDARG00000024219
ZFIN ID:
ZDB-GENE-030131-6392
Description:
myomegalin [Source:RefSeq peptide;Acc:NP_956195]
Human Orthologue:
CDK5RAP2
Human Description:
CDK5 regulatory subunit associated protein 2 [Source:HGNC Symbol;Acc:18672]
Mouse Orthologue:
Cdk5rap2
Mouse Description:
CDK5 regulatory subunit associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2384875]

Alleles

There are 18 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8639 Nonsense Mutation detected in F1 DNA During 2018
sa23850 Essential Splice Site Available for shipment Available now
sa9261 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12833 Nonsense Available for shipment Available now
sa23849 Nonsense Available for shipment Available now
sa32328 Nonsense Available for shipment Available now
sa44952 Nonsense Mutation detected in F1 DNA During 2018
sa39315 Nonsense Mutation detected in F1 DNA During 2018
sa37219 Nonsense Mutation detected in F1 DNA During 2018
sa31053 Nonsense Mutation detected in F1 DNA During 2018
sa43575 Nonsense Mutation detected in F1 DNA During 2018
sa43574 Nonsense Mutation detected in F1 DNA During 2018
sa37218 Nonsense Available for shipment Available now
sa29501 Nonsense Mutation detected in F1 DNA During 2018
sa23848 Nonsense Available for shipment Available now
sa43573 Nonsense Mutation detected in F1 DNA During 2018
sa43572 Nonsense Mutation detected in F1 DNA During 2018
sa37217 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 76 1209 4 28
ENSDART00000122131 Nonsense 76 2784 4 49
Genomic Location (Zv9):
Chromosome 21 (position 4940574)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4517986
GRCz11 21 4682551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATCACAGCACTAAAAAAAGAAAACTTCAACCTGAAGCTCAGGATCTA[T/A]TTTCTAGAAGAGCGTGTGCAGCAGAAATGTGACGACTCCACAGARGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Essential Splice Site 96 1209 4 28
ENSDART00000122131 Essential Splice Site 96 2784 4 49
Genomic Location (Zv9):
Chromosome 21 (position 4940512)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4517924
GRCz11 21 4682489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGTGCAGCAGAAATGTGACGACTCCACAGAGGACATTTACAAAACGG[T/A]AACATTATTTATTTTTGGATATGAATGCAAAGAGGTGCTTTTTTGTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Essential Splice Site 221 1209 7 28
ENSDART00000122131 Essential Splice Site 221 2784 7 49
Genomic Location (Zv9):
Chromosome 21 (position 4937831)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4515243
GRCz11 21 4679808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCCAACAGGTCCGAGAGCTTCAGCAGGCCCTTCAGGAGAGCGAAAGG[T/C]GATTATGAAATDAAATAWTAAACAAGTTTACATGCWKTAACWGTTAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 286 1209 9 28
ENSDART00000122131 Nonsense 286 2784 9 49
Genomic Location (Zv9):
Chromosome 21 (position 4934183)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4511595
GRCz11 21 4676160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTAGGGAAGAACTTGACCAGGGAAAAGAAAATGCAGAAAGGGACAAA[C/T]AGGTAAGCGGAAAGCCATTYAATTATAATGCWTACCAGGACGATRAMCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 505 1209 14 28
ENSDART00000122131 Nonsense 505 2784 14 49
ENSDART00000031425 Nonsense 505 1209 14 28
ENSDART00000122131 Nonsense 505 2784 14 49
Genomic Location (Zv9):
Chromosome 21 (position 4925066)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4502478
GRCz11 21 4667043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGACCGAGAGAACGCTCTAGATCAACAGCGTCTAGAGCAGCAGGAA[C/T]AGATCCGAGCATCAGAACAGAAGATGCAGAACGCCATGGAGAGACTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 505 1209 14 28
ENSDART00000122131 Nonsense 505 2784 14 49
ENSDART00000031425 Nonsense 505 1209 14 28
ENSDART00000122131 Nonsense 505 2784 14 49
Genomic Location (Zv9):
Chromosome 21 (position 4925066)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4502478
GRCz11 21 4667043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGACCGAGAGAACGCTCTAGATCAACAGCGTCTAGAGCAGCAGGAA[C/T]AGATCCGAGCATCAGAACAGAAGATGCAGAACGCCATGGAGAGACTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 630 1209 17 28
ENSDART00000122131 Nonsense 630 2784 17 49
Genomic Location (Zv9):
Chromosome 21 (position 4918889)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4496301
GRCz11 21 4660866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTAGAGTTTTGATGCTGTCATAAAGGAGAGAGATCTGGAGCTGCAG[C/T]AGCTGTTGAACTCTCTGAAGAATCTGCAGAGGAGTAAAGACGAGACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 684 1209 18 28
ENSDART00000122131 Nonsense 684 2784 18 49
Genomic Location (Zv9):
Chromosome 21 (position 4917795)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4495207
GRCz11 21 4659772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATTTTTCCAAACTTGTTTTACAGGAAATGGCCAATAGGGTTCTGAAC[C/T]AGTCAGAGTCCCAGGGACGTGACCTCGCAGAGCAGATGAGTCAGAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 870 1209 21 28
ENSDART00000122131 Nonsense 870 2784 21 49
Genomic Location (Zv9):
Chromosome 21 (position 4915017)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4492429
GRCz11 21 4656994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCGAAACAGTGAGGAAATGCTGGATGTGGATGCAGTCACTAAGAAAT[C/A]AGCAGTGCTTTTGAAGAGAGAGCTCTTACAGAAAACCGATGCTCTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 948 1209 23 28
ENSDART00000122131 Nonsense 948 2784 23 49
ENSDART00000031425 Nonsense 948 1209 23 28
ENSDART00000122131 Nonsense 948 2784 23 49
Genomic Location (Zv9):
Chromosome 21 (position 4912369)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4489781
GRCz11 21 4654346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTTTCTGCAGGAACTTCACCACCGTTTGTCTCAAAGAGGCGACAGT[C/T]GAGTTCCTCTAACCCGCGATCAAGCCTCACAGCTCGGAGAGAGTGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 948 1209 23 28
ENSDART00000122131 Nonsense 948 2784 23 49
ENSDART00000031425 Nonsense 948 1209 23 28
ENSDART00000122131 Nonsense 948 2784 23 49
Genomic Location (Zv9):
Chromosome 21 (position 4912369)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4489781
GRCz11 21 4654346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTTTCTGCAGGAACTTCACCACCGTTTGTCTCAAAGAGGCGACAGT[C/T]GAGTTCCTCTAACCCGCGATCAAGCCTCACAGCTCGGAGAGAGTGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 1108 1209 26 28
ENSDART00000122131 Nonsense 1108 2784 26 49
Genomic Location (Zv9):
Chromosome 21 (position 4907902)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4485314
GRCz11 21 4649879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCAAGCCCGACTGGGACAAATCCAGAATCGGGGAGGTGGTGTTGGA[C/T]AGGCCAATGATTCTGGTACTTAAATCTAAATACTGTAGATAAATGAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425 Nonsense 1167 1209 28 28
ENSDART00000122131 Nonsense 1167 2784 28 49
Genomic Location (Zv9):
Chromosome 21 (position 4905960)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4483372
GRCz11 21 4647937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGAGCTTGAGGCAGTAAATGCTGAATTACAGAAGAAGCTGGTTCTGT[T/A]GGAGAAAGACACTGTGGGAAATGCTCCAATAGGCTCTCACTCTCAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425   None 1209 None 28
ENSDART00000122131 Nonsense 1338 2784 31 49
Genomic Location (Zv9):
Chromosome 21 (position 4902191)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4479603
GRCz11 21 4644168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGTGAAGGTGCTTCGCTCTGAAGCCAGAAGTCACCGGAAGATTATA[C/T]GATTCCTAAAAGAGCAGCTGGAACGTAACTCAGATGGCGTAACTCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425   None 1209 None 28
ENSDART00000122131 Nonsense 1449 2784 32 49
Genomic Location (Zv9):
Chromosome 21 (position 4900985)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4478397
GRCz11 21 4642962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAGTAGGAGTACCGGACAGAGTTCTGAAGATCTGAGTGAAGTAAATT[C/A]AGACCACATTCAACCCAAGAGAAAAGACCACCAGACTGGGGCAGAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425   None 1209 None 28
ENSDART00000122131 Nonsense 1714 2784 32 49
Genomic Location (Zv9):
Chromosome 21 (position 4900190)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4477602
GRCz11 21 4642167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGCAGCAGTGCAAGCTGAACTCAGAACTACAGGAGAAACTCTGGATTT[C/A]AGAAGCAGCCTTTAAAAAGTTGAGTTCAACTAAAAACGGTGCACCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425   None 1209 None 28
ENSDART00000122131 Nonsense 1955 2784 33 49
Genomic Location (Zv9):
Chromosome 21 (position 4896990)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4474402
GRCz11 21 4638967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAGCGCCCCCTGGTGAACGGGATGATAAAGGGGTGCAGGTGGAGGCG[C/T]AGGACCTCGGGTACGAAACGAGTGGAAGGAGTGAGACGGAGGTGGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031425   None 1209 None 28
ENSDART00000122131 Nonsense 2037 2784 34 49
Genomic Location (Zv9):
Chromosome 21 (position 4894775)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4472187
GRCz11 21 4636752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGAACCACACGCTGACTCCAACATGCACATTCAGCAGCTCCGGTCG[C/T]AGATCGAAGGACAGCACAGAGTCATCCAGCACCTGCAGAGACAGCTGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link