zgc:56010

Ensembl ID:
ENSDARG00000024209
ZFIN ID:
ZDB-GENE-040426-865
Description:
hypothetical protein LOC394056 [Source:RefSeq peptide;Acc:NP_957375]
Human Orthologue:
WASF2
Human Description:
WAS protein family, member 2 [Source:HGNC Symbol;Acc:12733]
Mouse Orthologue:
Wasf2
Mouse Description:
WAS protein family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1098641]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36914 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088213   None 255 None 6
ENSDART00000110895   None 256 None 7
ENSDART00000113031 Nonsense 476 486 9 9
Genomic Location (Zv9):
Chromosome 19 (position 45042273)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43945782
GRCz11 19 43541379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTGTCTCGCCGCATCGCCGTGGAGTGCAGCGACTCTGAGGATGATT[C/A]GTCTGAGTTTGATGATGATGACTGGTCCGACTGAAGCATCTTCATCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link