
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gmppaa
- Ensembl ID:
- ENSDARG00000024112
- ZFIN ID:
- ZDB-GENE-040704-37
- Description:
- Mannose-1-phosphate guanyltransferase alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q6GMK8]
- Human Orthologue:
- GMPPA
- Human Description:
- GDP-mannose pyrophosphorylase A [Source:HGNC Symbol;Acc:22923]
- Mouse Orthologue:
- Gmppa
- Mouse Description:
- GDP-mannose pyrophosphorylase A Gene [Source:MGI Symbol;Acc:MGI:1916330]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18238 | Essential Splice Site | Available for shipment | Available now |
sa41361 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18238
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003543 | Essential Splice Site | 14 | 422 | 1 | 12 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10995847)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10799604 GRCz11 9 10770921 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAGCAAGCATGCTGAAGGCTGTCATTCTTATCGGAGGCCCCCAAAAAGG[T/G]GAGTAAACATCCGTCTGACWCTTTTCAGCAGTTCRGATTGACATYATAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41361
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003543 | Essential Splice Site | 46 | 422 | 2 | 12 |
- Genomic Location (Zv9):
- Chromosome 9 (position 10996499)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 10800256 GRCz11 9 10771573 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGGCCGGAGTGCCAATGCTGCAGCATCACATTGAGGCCTGCTCTAAGG[T/A]AAAGTACTCATTTTACACTTTGAAAACAATATGATATATTAGCACATCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: