si:dkey-37g12.4

Ensembl ID:
ENSDARG00000024101
ZFIN ID:
ZDB-GENE-090312-203
Description:
Novel protein similar to H.sapiens ADRA1D, adrenergic, alpha-1D-, receptor (ADRA1D) [Source:UniProtK
Human Orthologue:
ADRA1D
Human Description:
adrenergic, alpha-1D-, receptor [Source:HGNC Symbol;Acc:280]
Mouse Orthologue:
Adra1d
Mouse Description:
adrenergic receptor, alpha 1d Gene [Source:MGI Symbol;Acc:MGI:106673]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa779 Nonsense Available for shipment Available now
sa38284 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014678 Nonsense 161 491 1 2
ENSDART00000134234 Nonsense 110 312 1 2
Genomic Location (Zv9):
Chromosome 1 (position 42364299)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41280615
GRCz11 1 41981779
KASP Assay ID:
554-0684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCACTATCATGACCGAACGGAAAGCGGGTGTCATACTYGTGCTAGTGT[G/A]GGTTTCTTCGATGGTCATTTCAATCGGACCGCTTTTGGGATGGAAGGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014678 Nonsense 408 491 2 2
ENSDART00000134234   None 312 None 2
Genomic Location (Zv9):
Chromosome 1 (position 42343829)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41260145
GRCz11 1 41961309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCCCCTTTCACGAGCAGTGCAGTAACTCGATATATTCCTGCCAGAGC[A/T]AGCGCAGGCCTCTTAGTCTGAAGAGCTGGAGGTTTTTCCCCCCTTTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link