zgc:77513

Ensembl ID:
ENSDARG00000024090
ZFIN ID:
ZDB-GENE-030131-3093
Description:
dnaJ homolog subfamily C member 4 [Source:RefSeq peptide;Acc:NP_997842]
Human Orthologue:
DNAJC4
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 4 [Source:HGNC Symbol;Acc:5271]
Mouse Orthologue:
Dnajc4
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 4 Gene [Source:MGI Symbol;Acc:MGI:1927346]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42346 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35636 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038847 Essential Splice Site None 237 None 9
ENSDART00000102647   None 237 None 6
ENSDART00000148210 Essential Splice Site None 237 None 8

The following transcripts of ENSDARG00000024090 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 8445766)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8169010
GRCz11 14 8475124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGCAACAGAACATCCACAGCTGACCTGCGCGTCTCCATGAATGAAGG[T/G]GACGCCATTATTTATGTTTAATCCGCTGATTAATGACTTACTAATAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038847 Nonsense 108 237 5 9
ENSDART00000102647 Nonsense 108 237 3 6
ENSDART00000148210 Nonsense 108 237 5 8

The following transcripts of ENSDARG00000024090 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 8455780)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8179024
GRCz11 14 8485138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCAGACAGGATTATGACCTCAGGCTGAGGTACCAGTATGCTGGAGGT[C/T]AGGCCTTCAGAACCTCCTCCAGCTCCTCCAACAATCCCAGGTGAGAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link