tmem38a

Ensembl ID:
ENSDARG00000024047
ZFIN ID:
ZDB-GENE-040426-1888
Description:
Trimeric intracellular cation channel type A [Source:UniProtKB/Swiss-Prot;Acc:Q6P2T0]
Human Orthologue:
TMEM38A
Human Description:
transmembrane protein 38A [Source:HGNC Symbol;Acc:28462]
Mouse Orthologue:
Tmem38a
Mouse Description:
transmembrane protein 38A Gene [Source:MGI Symbol;Acc:MGI:1921416]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35020 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035560 Nonsense 208 295 5 6
Genomic Location (Zv9):
Chromosome 11 (position 7359963)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7165389
GRCz11 11 7175228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGGAGCCATTTTATTCACTCTCCAGGAGGCTCACGTGCTCCCTGTGT[C/A]GAAGAGCACACTCATCTGCCTCTTCACACTTTTCATGGTCTCATCCAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link