zgc:110246

Ensembl ID:
ENSDARG00000024037
ZFIN ID:
ZDB-GENE-050417-98
Description:
prenylcysteine oxidase [Source:RefSeq peptide;Acc:NP_001017626]
Human Orthologue:
PCYOX1
Human Description:
prenylcysteine oxidase 1 [Source:HGNC Symbol;Acc:20588]
Mouse Orthologue:
Pcyox1
Mouse Description:
prenylcysteine oxidase 1 Gene [Source:MGI Symbol;Acc:MGI:1914131]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34831 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039388 Nonsense 225 509 5 7
Genomic Location (Zv9):
Chromosome 10 (position 6257143)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7700310
GRCz11 10 7659010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGGTCTTCCTCAATGACATTGTTACCCCTGTCACACGAGTCAACTA[C/A]GGACAGACTGTTCGAATCAATGGATTTGTAGGTATGCAAATTGATCGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link