zgc:194138

Ensembl ID:
ENSDARG00000024030
ZFIN ID:
ZDB-GENE-080721-15
Description:
angiopoietin-like 2b [Source:RefSeq peptide;Acc:NP_001025401]
Human Orthologue:
ANGPTL2
Human Description:
angiopoietin-like 2 [Source:HGNC Symbol;Acc:490]
Mouse Orthologue:
Angptl2
Mouse Description:
angiopoietin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1347002]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20336 Nonsense Available for shipment Available now
sa45185 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067599 Nonsense 363 525 2 4
Genomic Location (Zv9):
Chromosome 5 (position 4754155)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4393569
GRCz11 5 4818233
KASP Assay ID:
2259-5378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGCTGGACCGTCATTCAGAGACGCATGGACGGATCCGTCAACTTCTTC[A/T]GAAACTGGGAGACATATAAGGTCAGAAAGTCATGTTCGCTCACTAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067599 Nonsense 395 525 3 4
Genomic Location (Zv9):
Chromosome 5 (position 4761255)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4400669
GRCz11 5 4825333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGGCTGGGTCTGGAGAACATCTACTGGCTGACCAATCAGGGCAACTA[T/A]AAACTGCTGGTGACGCTGGAGGACTGGAGCGGCCGCAAGACCTTCGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link