zgc:100787

Ensembl ID:
ENSDARG00000023989
ZFIN ID:
ZDB-GENE-040801-259
Description:
Peflin [Source:UniProtKB/Swiss-Prot;Acc:Q6DC93]
Human Orthologue:
PEF1
Human Description:
penta-EF-hand domain containing 1 [Source:HGNC Symbol;Acc:30009]
Mouse Orthologue:
Pef1
Mouse Description:
penta-EF hand domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915148]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36885 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032341 Essential Splice Site 95 270 2 5
Genomic Location (Zv9):
Chromosome 19 (position 38671490)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37535473
GRCz11 19 37122593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTATGGACAACCTCAAGGAGGACCATACCGTCAGCAGGGATCAGCAGG[T/C]TAGACATGTGTAACTCTACTGTGTTTTAGTTGGGCTAAGTATTATATAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link