si:dkey-85k8.8

Ensembl ID:
ENSDARG00000023914
ZFIN ID:
ZDB-GENE-060531-156
Description:
Novel protein similar to MAP/microtubule affinity-regulating kinase protein family [Source:UniProtKB
Human Orthologue:
MARK4
Human Description:
MAP/microtubule affinity-regulating kinase 4 [Source:HGNC Symbol;Acc:13538]
Mouse Orthologue:
Mark4
Mouse Description:
MAP/microtubule affinity-regulating kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1920955]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40500 Nonsense Mutation detected in F1 DNA During 2018
sa20479 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087191 Nonsense 58 754 2 18
ENSDART00000146854 Nonsense 14 699 2 17
Genomic Location (Zv9):
Chromosome 5 (position 38386888)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36186572
GRCz11 5 36786725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTAACTCCATGGCTTCTTACTCAGACGAGCTACCGCACATCGGAAACTA[C/A]CGGCTCCTTAAAACCATTGGCAAGGGCAACTTTGCTAAAGTCAAACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087191 Nonsense 524 754 14 18
ENSDART00000146854 Nonsense 480 699 14 17
Genomic Location (Zv9):
Chromosome 5 (position 38410055)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36209739
GRCz11 5 36809892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGACCCGCAGAAACACATATGTATGTACGGATCGTTCCAGCACTGAC[C/T]GACACTCTCTGCTGCAGAACGGCAAAGACAACAGGTGTCAAAAACATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link