pfkfb2

Ensembl ID:
ENSDARG00000023840
ZFIN ID:
ZDB-GENE-040426-966
Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 [Source:RefSeq peptide;Acc:NP_957302]
Human Orthologue:
PFKFB2
Human Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 [Source:HGNC Symbol;Acc:8873]
Mouse Orthologue:
Pfkfb2
Mouse Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:107815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45813 Nonsense Mutation detected in F1 DNA During 2018
sa24409 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102328 Nonsense 311 522 10 16
Genomic Location (Zv9):
Chromosome 23 (position 43158576)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42895128
GRCz11 23 42787732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTAGACGCACGATTCAGACGGCGGAAGAGCTGGGCGTCCCGTACGAA[C/T]AGTGGAAAATCCTCAACGAGATCGACGCTGTAAGTTCAGTCCTGTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102328 Nonsense 374 522 12 16
Genomic Location (Zv9):
Chromosome 23 (position 43150572)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42887124
GRCz11 23 42779728
KASP Assay ID:
2261-8218.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGGATCTGGTCCAGCGTCTGGAGCCGGTCATCATGGAGCTGGAGAGA[C/T]AAGGAAACGTGCTGGTGATCTGCCATCAGGCTGTCATGCGCTGCCTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link