zgc:55420

Ensembl ID:
ENSDARG00000023820
ZFIN ID:
ZDB-GENE-040426-2907
Description:
hypothetical protein LOC406828 [Source:RefSeq peptide;Acc:NP_998672]
Human Orthologue:
C5orf4
Human Description:
chromosome 5 open reading frame 4 [Source:HGNC Symbol;Acc:1334]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6686 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038657 Essential Splice Site 36 323 3 8
Genomic Location (Zv9):
Chromosome 21 (position 44169034)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45805236
GRCz11 21 45844868
KASP Assay ID:
554-5031.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGGCGGCGGCNNNGGTCAGTGACGTGTGGAGCGCTGCTGTKTGTTTCCTC[A/T]GGCATCTGCAGAGGTTTTGGGGAGCGTCTGGAGACTTCTGGCAGACGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link