zgc:73226

Ensembl ID:
ENSDARG00000023759
ZFIN ID:
ZDB-GENE-050703-8
Description:
Bcl-2/adenovirus E1B 19kD interaction protein XR [Source:RefSeq peptide;Acc:NP_991133]
Human Orthologues:
AL139023.1, BNIP3, BNIP3L
Human Descriptions:
BCL2/adenovirus E1B 19kDa interacting protein 3 [Source:HGNC Symbol;Acc:1084]
BCL2/adenovirus E1B 19kDa interacting protein 3-like [Source:HGNC Symbol;Acc:1085]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JG85]
Mouse Orthologues:
Bnip3, Bnip3l
Mouse Descriptions:
BCL2/adenovirus E1B interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:109326]
BCL2/adenovirus E1B interacting protein 3-like Gene [Source:MGI Symbol;Acc:MGI:1332659]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40356 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031775 Nonsense 70 187 3 6
Genomic Location (Zv9):
Chromosome 5 (position 6259466)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5875209
GRCz11 5 6366364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATTAATTGCCTTTTATATTGATTTCCCTCTTTGATTTCAGTCCTCCA[C/T]AGGTCGTGACCCCCAGAACATCTGGATCTCCTAAACCAGGCAGTGAGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link