aqp1a.1

Ensembl ID:
ENSDARG00000023713
ZFIN ID:
ZDB-GENE-030131-7764
Description:
aquaporin 1 [Source:RefSeq peptide;Acc:NP_996942]
Human Orthologues:
AQP1, RP5-877J2.1
Human Descriptions:
aquaporin 1 (Colton blood group) [Source:HGNC Symbol;Acc:633]
cDNA FLJ51453, highly similar to Aquaporin-1 [Source:UniProtKB/TrEMBL;Acc:B4E220]
Mouse Orthologue:
Aqp1
Mouse Description:
aquaporin 1 Gene [Source:MGI Symbol;Acc:MGI:103201]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39746 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32826 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032459 Essential Splice Site 174 260 2 4
Genomic Location (Zv9):
Chromosome 2 (position 2894094)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2901119
GRCz11 2 2743018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTCCTCTGGCCATCGGCCTCAGTGTTTGCCTGGGACATCTGACAGCC[G/A]TGAGTAATCAGCATTCACACTTCCACCGCTCTATTTTCTTTACCACGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032459 Essential Splice Site 175 260 3 4
Genomic Location (Zv9):
Chromosome 2 (position 2896515)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2903540
GRCz11 2 2745439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTCAATCCTCAGCATGGTCATCATCGTGTGTTGTTTCTCTCTGTGT[A/T]GATCAGCTTCACGGGATGTGGAATCAATCCTGCTCGAACATTCGGACCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Nephrolithiasis: A genome-wide association study of nephrolithiasis in the Japanese population identifies novel susceptible Loci at 5q35.3, 7p14.3, and 13q14.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link