zfyve9

Ensembl ID:
ENSDARG00000023701
ZFIN ID:
ZDB-GENE-070705-182
Description:
Novel protein similar to human and mouse zinc finger, FYVE domain containing 9 (ZFYVE9) [Source:UniP
Human Orthologues:
AC055876.2, ZFYVE9
Human Description:
zinc finger, FYVE domain containing 9 [Source:HGNC Symbol;Acc:6775]
Mouse Orthologue:
Zfyve9
Mouse Description:
zinc finger, FYVE domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2652838]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa51 Splice Site, Nonsense Confirmed mutation in F2 line During 2018
sa50 Nonsense Available for shipment Available now
sa19724 Nonsense Available for shipment Available now
sa44 Missense Confirmed mutation in F2 line During 2018
sa9383 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32886 Nonsense Available for shipment Available now
sa32887 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8528 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa51
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Splice Site, Nonsense 25 1216 2 17
ENSDART00000132283   None 842 None 16
Genomic Location (Zv9):
Chromosome 2 (position 19133251)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19670069
GRCz11 2 19319133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCAGTCTTTTCAAAAAGCTAATGAGCTTTCTTCTTATCCTTTCAGAT[G/T]AAACGGACACACCAATTCTCTCGGATGCCAAGTGGACTCAGATTCTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa50
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Nonsense 95 1216 2 17
ENSDART00000132283   None 842 None 16
Genomic Location (Zv9):
Chromosome 2 (position 19133461)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19669859
GRCz11 2 19318923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCTCTTTGGTTGAGGTCACCAGGTTAAATGGGAAACAGGGACTGGGA[C/T]AACAGCAAGAGGGCAAGAGTGAAGAACGGCCAGCAGATGTTTACAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Nonsense 115 1216 2 17
ENSDART00000132283   None 842 None 16
Genomic Location (Zv9):
Chromosome 2 (position 19133521)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19669799
GRCz11 2 19318863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCAAGAGTGAAGAACGGCCAGCAGATGTTTACAGTCCACCTCTGCCT[C/T]AGCCAAACATTGGCAAGCTAGTGAGCACTGACGGGCAGTTGGCAGACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Missense 487 1216 2 17
ENSDART00000132283 Missense 113 842 1 16
Genomic Location (Zv9):
Chromosome 2 (position 19134638)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19668682
GRCz11 2 19317746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTCTAAGAAGCCCTTGAGCTCCTTGGGGGAAGTGGCTCCAGTTTGGG[T/A]TCCTGACTCTCAAGCACCCATTTGCATGAAGTGCGAGGTCAAGTTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Essential Splice Site 550 1216 3 17
ENSDART00000132283 Essential Splice Site 176 842 2 16
Genomic Location (Zv9):
Chromosome 2 (position 19137896)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19665424
GRCz11 2 19314488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAAGAAGCGAGGGTTTGTGTTMCCTGCCACTGTGCATTAATAAATGG[T/A]GAGTAAYATGAAACTCAAGGGAGTGGTCAAACTGTAGGTTAGGTTAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Nonsense 613 1216 5 17
ENSDART00000132283 Nonsense 239 842 4 16
Genomic Location (Zv9):
Chromosome 2 (position 19140069)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19663251
GRCz11 2 19312315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAGCTTTAAACCCTCGTCTCTGTAATGCACTTGTAGGTTCTCTTCCT[C/T]GAGAGCAAAGGAGAGTTTGGTTTGCGGATGGCATTCTGCCCAATGGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Essential Splice Site 663 1216 5 17
ENSDART00000132283 Essential Splice Site 289 842 4 16
Genomic Location (Zv9):
Chromosome 2 (position 19140223)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19663097
GRCz11 2 19312161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTACATCCCAAAACTCAAACAAATCCTCAGGAGCCAATGCCTCTGAGG[T/C]GACACTTTACTTTGTTCTATTTAAGCTCATCTGTAAAATTAGACACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031837 Essential Splice Site 987 1216 12 17
ENSDART00000132283 Essential Splice Site 613 842 11 16
Genomic Location (Zv9):
Chromosome 2 (position 19157753)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19645567
GRCz11 2 19294631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAACTACCAGACGCAGGCCATTAGTATTCATCACCAGCCTCGCAAAG[G/A]TATGGCAAGATTACTTGCAAGCTAATCTTTGAAGCTTCTTTTTTCAYTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link