
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sh3gl2
- Ensembl ID:
- ENSDARG00000023600
- ZFIN ID:
- ZDB-GENE-040121-3
- Description:
- endophilin-A1 [Source:RefSeq peptide;Acc:NP_957410]
- Human Orthologue:
- SH3GL2
- Human Description:
- SH3-domain GRB2-like 2 [Source:HGNC Symbol;Acc:10831]
- Mouse Orthologue:
- Sh3gl2
- Mouse Description:
- SH3-domain GRB2-like 2 Gene [Source:MGI Symbol;Acc:MGI:700009]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19508 | Nonsense | Available for shipment | Available now |
sa12612 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19508
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090611 | Nonsense | 170 | 347 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome 1 (position 25715161)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 26055378 GRCz11 1 26749092 - KASP Assay ID:
- 2259-0639.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGACAGCATCACCTGAAGAAGCTGGAGGGGCGACGATTGGACTTTGACTA[T/A]AAGAAGAAAAGGCAAGGAAAAGTCACAGAGGATGAGATCAAACAGGCCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12612
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090611 | Nonsense | 211 | 347 | 7 | 9 |
- Genomic Location (Zv9):
- Chromosome 1 (position 25714192)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 26054409 GRCz11 1 26748123 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTCATGTGTTACAGTTAWTAATGTTCTAACTGTGTTTCACCAGATTGAG[C/T]AAGTGAGTCAGCTTTCTGCTCTGGTCCAAGCTCAAGTCAACTACCATAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (View Study)
- Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)
- Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Parkinson's disease: Meta-analysis of Parkinson's disease: identification of a novel locus, RIT2. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: