sim1a

Ensembl ID:
ENSDARG00000023316
ZFIN ID:
ZDB-GENE-020829-1
Description:
Single-minded homolog 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q98SJ5]
Human Orthologue:
SIM1
Human Description:
single-minded homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:10882]
Mouse Orthologue:
Sim1
Mouse Description:
single-minded homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:98306]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42641 Nonsense Mutation detected in F1 DNA During 2018
sa2864 Essential Splice Site F2 line generated During 2018
sa30996 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42640 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36012 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036348 Nonsense 36 745 2 12
ENSDART00000131787   None 462 None 4
Genomic Location (Zv9):
Chromosome 16 (position 1529293)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1478410
GRCz11 16 1502298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTTACGAGCTCGCCAAACTGCTGCCTCTGCCCTCCGCCATCACCTCA[C/T]AGCTGGACAAAGCCTCCATCATCAGACTCACCACCAGCTACCTGAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2864
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036348 Essential Splice Site 59 745 3 12
ENSDART00000131787   None 462 None 4
Genomic Location (Zv9):
Chromosome 16 (position 1523598)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1472715
GRCz11 16 1496603
KASP Assay ID:
554-3101.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TANTTAATATCGCCTAATAGCTTACTCTGAAGTGTTTAATRAATATTCCGC[A/T]GGTCTTGGGGAATCTTGGGGCCATGTGAGTCGAACGACTTCACTGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036348 Essential Splice Site 388 745 10 12
ENSDART00000131787 Essential Splice Site 105 462 2 4
ENSDART00000036348 Essential Splice Site 388 745 10 12
ENSDART00000131787 Essential Splice Site 105 462 2 4
Genomic Location (Zv9):
Chromosome 16 (position 1503456)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1452573
GRCz11 16 1476461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTCTCCCGAACCAAGACCAAAACAAGACTCTCTCCGTACTCACAG[G/T]TCAGTGTCGCAGTAGACTTAGTAGAATGCCTGACAAATTAGACTTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036348 Essential Splice Site 388 745 10 12
ENSDART00000131787 Essential Splice Site 105 462 2 4
ENSDART00000036348 Essential Splice Site 388 745 10 12
ENSDART00000131787 Essential Splice Site 105 462 2 4
Genomic Location (Zv9):
Chromosome 16 (position 1503456)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1452573
GRCz11 16 1476461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTCTCCCGAACCAAGACCAAAACAAGACTCTCTCCGTACTCACAG[G/T]TCAGTGTCGCAGTAGACTTAGTAGAATGCCTGACAAATTAGACTTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036348 Nonsense 718 745 12 12
ENSDART00000131787 Nonsense 435 462 4 4
Genomic Location (Zv9):
Chromosome 16 (position 1497513)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1446630
GRCz11 16 1470518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGACAGCTTTCGAGGATACTCCCTTGGGTGCTCTGGTTCCTCTCATTA[C/A]GATATGACCACTCATCTACGCATGCAGGCTGAACAAGCGCCGGGCCATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link